Skip to main content

Table 2 Primers used to amplify fragments suitable for detecting mutation by CTCE

From: Mapping mitochondrial heteroplasmy in a Leydig tumor by laser capture micro-dissection and cycling temperature capillary electrophoresis

    Template,fragment#    Annealing
# Start(bp) End(bp) fromfirstPCR “Forward” primer(5′–3′) “Reverse” primer(5′–3′) Temperature (°C)
1 16569 25 1 aTGCATGGAGAGCTCCCGTGAGTGG CCCCTTAAATAAGACATCACGAT 52
2 42 126 1 aATTAACCACTCACGGGAGCTCTC AGGATGAGGCAGGAATCAAAGAC 55
4 131 181 1 aCACCCTATGTCGCAGTATCTGTC CACACTTTAGTAAGTATGTTCGC 55
6 483 153 1 aGGGGTTAGCAGCGGTGTGTGTGTG TCCCACTCCCATACTACTAATCT 55
7 530 633 1 aTACCCAGCACACACACACCGCTG CAAACCTATTTGTTTATGGGGTGA 55
8 673 705 1 aTTAGAGGGTGAACTCACTGGAAC GGTTTGGTCCTAGCCTTTCTATT 58
82 7031 1734 10 aACGACACGTACTACGTTGTAGCC AATATGATAGTGAAATGGATTTT 52
84 7340 7416 10 aCTTTCTTCCCACAACACTTTCTC TCTCAAATCATGAAAATTATTAAT 55
125 11029 11086 16 aTTAGGAGGGGGGTTGTTAGGGGGT CATCCCTCTACTATTTTTTAACC 58
127 11193 11243 16 aACCAGCCAGAACGCCTGAACGCA GGTGTTGTGAGTGTAAATTAGTG 55
128 11283 11311 16 aTGTGCCTGCGTTCAGGCGTTCTGG TAATCATATTTTATATCTTCTTC 60
130 11437 11492 16 aTTGACCCAGCGATGGGGGCTTCGA GAGCCAACAACTTAATATGACTA 55
176 15201 15257 22 aAGAATCGTGTGAGGGTGGGACTGT AGTAATTACAAACTTACTATCCG 60
177 15274 15377 22 aAGTAGACAGTCCCACCCTCACAC GGTGATTTTATCGGAATGGGAGG 60
178 15394 15448 22 aCTAGGAATCACCTCCCATTCCGA TAATGTCATTAAGGAGAGAAGGAA 55
181 15761 15864 22 aACCTCCTCATTCTAACCTGAATC CAGGCCCATTTGAGTATTTTGTTT 55
184 16080 16130 23 aCAAGTATTGACTCACCCATCAAC ACAGGTGGTCAAGTATTTATGGTA 57
185 16170 16272 23 aGTGGGTGAGGGGTGGCTTTGGAGT CCAATCCACATCAAAACCCCCTC 56
187 16263 16366 23 aAACTGCAACTCCAAAGCCACCCC CCCTATCTGAGGGGGGTCATCCAT 58
  1. a=tailsequence(CCCGCCGCCCCCGCCCGGG)
  2. GC-Clamp=(6FAM-CGCCCGCCGCGCCCCGCGCCCGTCCCGCCGCCCCCGCCCGGG)
\