Skip to main content

Table 1 Primers used for amplification and sequencing of the RBL2 gene.

From: pRb2/p130 protein expression and RBL2 mutation analysis in Burkitt lymphoma from Uganda

Exon   Primer sequence (5'-3') Annealing temperature Product size (bp)
19-1 Forward AGGGTGTGCTCAACAAATAC 50 142
  Reverse CTGTTGGAGAATTCTGATGG   
19-2 Forward TCTCTAAAGGTGTATAGAAGTG 50 161
  Reverse GAAAAGCTCCTAATTTTGTC   
20-1 Forward ATTAGCAGCCTTTGTACTGAC 55 148
  Reverse ACTGTTGGCACCTGTGAGG   
20-2 Forward AGCAGTGCTCCTCCCACA 50 174
  Reverse AAAGTATGAAATAATCCCTG   
21 Forward CTCTCTCCCTATCCATTTG 50 143
  Reverse GGACTGTTGCTGAAGTAATAG   
22-1 Forward CTGAGCTATGTGCATTTGCA 52 148
  Reverse TTTGCAGGTGATTCACTTCC   
22-2 Forward AAAGAGAGGAATTCTTTTGG 54 145
  Reverse AGAGTTTAATACAAGAGACT