Skip to main content

Advertisement

Table 2 HPV-16, -31 and -33 variants with close sequence similarity at the L1 gene GP5+ primer binding site

From: Validation of human papillomavirus genotyping by signature DNA sequence analysis

Highly similar DNA sequence Genotype Locus
5'_acgcagtacaaatatgtcattatgtgctgccata HPV-16 EU779755
5'_acgcagtacaaatatgtcattatgtgctgccata HPV-31 EF140820
5'_acgcagtacaaatatgtcattatgtgctgccata HPV-33 DQ448214
5' tttgttggggtaaccaactatttgttactgttgt HPV-16 EU779755
5' tttgttggggcaatcagttatttgttactgtggt HPV-31 EU779751
5' tttgttggggcaatcaggtatttgttactgtggt HPV-33 EU779744
  1. DNA sequences retrieved from the National Center for Biotechnology Information database. The symbol _ and the underlined bases represent the end and the beginning of the GP5+ PCR priming site, respectively. A 34-base sequence shared by HPV-16 and certain HPV-31 (EF140820) and HPV-33 (DQ448214) strains is located immediately downstream of the GP5+ site. A 1- to 4-base difference is present upstream of the GP5+ site between certain variants of HPV-16, HPV-31 (EU779751) and HPV-33 (EU779744).